Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling
Authors
M. HAFIZHUL IMAN, PARAMITA CAHYANINGRUM KUSWANDI, SENA ADI SUBRATAFiles
Abstract Views: 159
File Views: 5
Abstract
Abstract. Iman MH, Kuswandi PC, Subrata SA. 2024. Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling. Biodiversitas 25: 355-360. Rusa deer is a vulnerable species with a large geographic range but natively inhabits Java and Bali. Despite the wide distribution, its native population is declining, raising a concern about a small population's adverse genetic effect. It encourages genetic studies to provide baseline data that has been vacant recently. This research aimed to demonstrate an application of non-invasive sampling to collect DNA samples and a simple procedure to obtain and analyze genetic data for the Rusa deer. This research also aimed to provide genetic variation of the native deer population as baseline data. The research sites were Baluran, Alas Purwo in East Java, and Bali Barat national parks from which fecal samples were collected. Moreover, 20 DNA samples were isolated from the feces using a kit (Dneasy PowerSoil Pro from Qiagen) and amplified at the control region gene using a forward: AAACCAGAAAAGGAGAGCAAC and a reverse: TCATCTAGGCATTTTCAGTGCC primer. The amplicons were sequenced, and the number of Haplotypes (Hn), Haplotype diversity (Hd), nucleotide diversity (p), site polymorphism, and phylogeographic tree were determined. The result showed that all the sequences had coverage of 100% and identity >98% with the Rusa timorensis sequence available in the GenBank. Furthermore, we found Hn = 11, Hd = 0.88, p = 0.005 and 30 site polymorphisms. Therefore, compared to an introduced population, the Rusa deer has a richer Hd and higher site polymorphism but a poorer p. Furthermore, we found that the Baluran population had high Hd, p, and is possibly forming a distinct clade.
References
Ali NANG, Abdullah ML, Nor SAM, Pau TM, Kulaimi NAM, Naim DM. 2021. A review of the genus Rusa in the Indo-Malayan archipelago and conservation efforts. Saudi J Biol Sci 28:10–26. DOI:10.1016/j.sjbs.2020.08.024
Ando H, Mukai H, Komura T, Dewi T, Ando M, Isagi Y. 2020. Methodological trends and perspectives of animal dietary studies by noninvasive fecal DNA metabarcoding. Environ DNA 2(4): 391–406. DOI: 10.1002/edn3.117
Angom S, Kumar A, Gupta SK, Hussain SA. 2017. Analysis of mtDNA control region of an isolated population of Eld’s deer (Rucervus eldii) reveals its vulnerability to inbreeding. Mitochondrial DNA B Resour 2(1):277–80. DOI: 10.1080/23802359.2017.1325335
Banks SC, Piggott MP. 2022. Non-invasive genetic sampling is one of our most powerful and ethical tools for threatened species population monitoring: a reply to Lavery et al. Biodivers Conserv (31): 723–8. DOI:10.1007/s10531-022-02377-x.
Edelhoff H, Zachos FE, Fickel J, Epps CW, Balkenhol N. 2020. Genetic analysis of red deer (Cervus elaphus) administrative management units in a human-dominated landscape. Conserv Genet 21(2): 261–276. DOI:10.1007/s10592-020-01248-8.
Ferreira CM, Sabino-Marques H, Barbosa S, Costa P, Encarnação C, Alpizar-Jara R, Pita R, Beja P, Mira A, Searle JB, Paupério J, Alves PC. 2018. Genetic non-invasive sampling (gNIS) is a cost-effective tool for monitoring elusive small mammals. Eur J Wildl Res 64(46):1-15. DOI: 0.1007/s10344-018-1188-8.
de Garine-Wichatitsky M, de Meeûs T, Chevillon C, Berthier D, Barré N, Thevenon S, Maillard JC. 2009. Population genetic structure of wild and farmed rusa deer (Cervus timorensis russa) in New Caledonia inferred from polymorphic microsatellite loci. Genetica 137(3):313. DOI 10.1007/s10709-009-9395-6.
Fitzpatrick SW, Funk WC. 2019. Genomics for Genetic Rescue. In: Hohenlohe PA, Rajora OP (eds.). Population Genomics: Wildlife. Springer, Cham. DOI:10.1007/13836-2019-64.
Ghazi MG, Sharma SP, Tuboi C, Angom S, Gurumayum T, Nigam P, Hussain SA. 2021a. Population genetics and evolutionary history of the endangered Eld’s deer (Rucervus eldii) with implications for planning species recovery. Sci Rep 11:2654 . DOI:10.1038/s41598-021-82183-7
Ghazi MG, Hussain SA, Gupta SK. 2021b. Detection of 40 bp tandem repeat motif and associated insertions and deletions (indel) in the mitochondrial DNA control region of Sambar deer (Rusa unicolor). Mol Biol Rep 48(5): 4129–4135. DOI: 10.1007/s11033-021-06426-6
Goossens B, Salgado-lynn M. 2013. Advances and difficulties of molecular tools for carnivore conservation in the tropics. Raffles Bull Zool 28:43–53.
Grant WS, Bowen BW.1998. Shallow population histories in deep evolutionary lineages of marine fishes: insights from Sardines and Anchovies and lessons for conservation. J Hered 89(5):415-426. DOI:10.1093/jhered/89.5.415
Gupta SK, Kumar A, Van Berkel T, Emsens WJ, Singh B, Puls S, Naroeun R, Merlijn J. 2022. Genetic analysis reveals a distinct lineage of Hog deer (Axis porcinus) in Kratie Province, Cambodia. J Hered 113(4):444–452. DOI: 10.1093/jhered/esac017.
Hall T. 2004. BioEdit version 7.0.0. Ibis Therapeutics, a division of Isis Pharmaceuticals, Inc. Available from: https://thalljiscience.github.io
Hedges S, Duckworth JW, Timmins R, Semiadi G, Dryden G. 2015. Rusa timorensis. The IUCN Red List of Threatened Species 2015: e.T41789A22156866. https://dx.doi.org/10.2305/IUCN.UK.2015-2.RLTS.T41789A22156866.en.
Khan A, Tyagi A. 2021. Considerations for initiating a wildlife genomics research project in South and South-East Asia. J Indian Inst Sci 101(2):243–56. DOI: 10.1007/s41745-021-00243-3.
Kumar A, Ghazi MG, Hussain SA, Bhatt D, Gupta SK. 2017. Mitochondrial and nuclear DNA based genetic assessment indicated distinct variation and low genetic exchange among the three subspecies of Swamp deer (Rucervus duvaucelii). Evol Biol 44(1):31–42. DOI: 10.1007/s41745-021-00243-3
Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol 35(6):1547–9. DOI: 10.1093/molbev/msy096.
Leandro SFS, Carnelossi EAG, Peres PHF, Ribeiro RC, Duarte JMB. 2022. Definition of mtDNA markers for studies in Pampas deer (Ozotoceros bezoarticus) based on fecal samples. Int J Sci Res Biol Sci 9(5):1–08. DOI:10.26438/ijsrbs/v9i5.18.
Linacre A, Tobe S. 2013. Wildlife DNA Analysis: Application in forensic science (1st ed.). Wiley-Blackwell, West Sussex.
Nugroho A, Susanto D, Subrata SA. 2022. Ageing and the amount of DNA extracted from Bawean deer (Axis kuhlii) feces. Biotropia 29(2):181-184. DOI: 10.11598/btb.2022.29.2.1709.
Rahman DA, Condro AA, Rianti P, Masy’ud B, Aulagnier S, Semiadi G. 2020. Geographical analysis of the Javan deer distribution in Indonesia and priorities for landscape conservation. J Nat Conserv 54:125795. DOI: 10.1016/J.JNC.2020.125795.
Rozas J, Ferrer-Mata A, Sanchez-DelBarrio JC, Guirao-Rico S, Librado P, Ramos-Onsins SE, Sanchez-Gracia A. 2017. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol Biol Evol 34(12):3299–3302. DOI:10.1093/molbev/msx24.
Singh VK, Joshi BD, Singh A, Singh SK, Chandra K, Sharma LK, Takhur M. 2022. Genetic diversity and population structure of the northern red Muntjac (Muntiacus vaginalis) in Indian Himalayan region. Mamm Biol 102(2):537–44. DOI: 0.1007/s42991-022-00254-2.
Spaggiari J, De Garine?Wichatitsky M. 2006. Home range and habitat use of introduced rusa deer (Cervus timorensis russa) in a mosaic of savannah and native sclerophyll forest of New Caledonia. N Z J Zool 33(3):175–83. DOI 10.1080/03014223.2006.9518442.
Zein MSA. 2007. Keragaman daerah kontrol DNA mitokondria Rusa Timor (Cervus timorensis timorensis) di Pulau Timor, Alor, dan Pantar. Biota 12(3):138–44.
Zhou CL, Turdy R, Halik M. 2015. Genetic differentiation between red deer from different sample sites on the Tianshan Mountains (Cervus elaphus), China. Mitochondrial DNA 26(1):101–11. DOI: 10.3109/19401736.2014.984165.
